Imaging:Article Title: Integration of transcriptomes of senescent cell models with multi-tissue patient samples reveals reduced COL6A3 as an inducer of senescence.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti rabbit Alexa Fluor 594 Life Technology Thermo Fisher Scientific Cat# A-11037; RRID:AB_2534095 p16 antibody clone E6H4 Roche Roche Cat# 705–4793; RRID:AB_2833232 Ki67 antibody Thermo RM 9106-50 Goat anti mouse Alexa Fluor 647 Thermo Thermo Fisher Scientific Cat# A32728; RRID:AB_2633277 ClickiT EdU Alexa Fluor 488 imaging kit Thermo C10337 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin Corning 30-002-Cl Hoechst 33342 Fisher H3570 FBS (validation experiments) Gibco 10438–026 EGM-2 Bulletkit Lonza CC-3162 REGM Bulletkit Lonza CC-3190 EGM-2 MV Bulletkit Lonza CC-3202 ADSC Bulletkit Lonza PT-4505 Power SYBRTM Green PCR Master Mix Applied Biosystems 4368706 Control shRNA lentiviral particles Santa Cruz sc-108080 COL6A3 shRNA lentiviral particles Santa Cruz sc-94560-V Doxycycline hyclate Sigma D9891 Insulin Thermo 12585014 Trizol Thermo 15596018 Puromycin ThermoFisher A1113803 DAPI containing mounting medium Vector Laboratories H-1500 Vestashield Mounting Medium for fluorescence Vector Laboratory Inc H-1000 DMEM medium VWR VWRL0101-0500 Bleomycin SelleckChem Catalog No.S1214 Oligomycin SelleckChem Catalog No.S1214 Rotenone Sigma Catalog No.A8674 Antimycin SelleckChem Catalog No.S2348 Critical commercial assays RNeasy Mini Kit Qiagen 74104 Super script IV Kit Invitrogen 180901050 Senescence Detection Kit K320 BioVision https://www.biovision.com/products/ aging/aging-assay-kits/ senescence-detection-kit.html TruSeq Stranded mRNA library prep kit Illumina https://www.illumina.com/products/ by-type/sequencing-kits/library-prep-kits/ truseq-stranded-mrna.html RNase-free DNase Set Qiagen 79254 Deposited data RNAseq data GEO GSE230181 and GSE230357 Experimental models: Cell lines Human Adipose-derived Stem Cells (ADSC) Lonza PT-5006 Human lung fibroblasts IMR-90 cells (IMR90) ATCC Cat# CCL-186; RRID:CVCL_0347 (Continued on next page) Cell Reports 42, 113371, November 28, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Microvascular Endothelial Cells (HMVEC) Lonza CC-2527 Human Umbilical Vein Endothelial Cells (HUVEC) Lonza C2519A Renal Proximal Tubule Epithelial Cells (RPTEC) Lonza CC-2553 Oligonucleotides COL6A3 Forward primers GAAGCAGAACCTCACGGTCA This paper N/A COL6A3 Reverse primers GTAGCAGACCACAGCCACAT This paper N/A RPLP0 Forward primers: GTGATGCCCAGGGAAGACAA This paper N/A RPLP0 Reverse primers: CCACATTGTCTGCTCCCACA This paper N/A Software and algorithms TopHat2 Kim et al.51 TopHat (RRID:SCR_013035); http://ccb.jhu.edu/software/tophat Cufflinks Trapnell et al.52 Cufflinks (RRID:SCR_014597); https://github.com/cole-trapnell-lab/cufflinks DESeq2 Love et al.53 DESeq2 (RRID:SCR_015687); http://www.bioconductor.org/ packages/release/bioc/html/DESeq2.html HTSeq Anders et al.54 https://pypi.python.org/pypi/HTSeq SDS 2.2.1 software Applied Biosystems N/A STAR RNA-seq aligner v2.7.3a GitHub https://github.com/alexdobin/ STAR/releases?page=3 UpSet plot https://upset.app/ UpSet (RRID:SCR_022731); https://www.rdocumentation.org/ packages/UpSetR/versions/1.4.0 Reactome Reactome Reactome (RRID:SCR_003485); https://reactome.org/ ClueGO (v2.5.6) Cytoscape App Store,55 https://apps.cytoscape.org/apps/cluego Cytoscape (v3.7.2) Cytoscape, Shannon et al.56 Cytoscape (RRID:SCR_003032); https://cytoscape.org/ Ingenuity Pathways Analysis Qiagen, Kramer et al.57 Ingenuity Pathway Analysis (RRID:SCR_008653); https://digitalinsights.qiagen.com/ product-login/ ImageJ NIH ImageJ (RRID:SCR_003070); https://imagej.nih.gov/ij/ GSEA v4.1.0 [build:27] GSEA-MSigDB; Subramanian et al., and Mootha et al.58,59 Gene Set Enrichment Analysis (RRID:SCR_003199); https://www.gsea-msigdb.org/ gsea/index.jsp SuperExactTest Wang et al.60 https://cran.r-project.org/web/ packages/SuperExactTest/index.html All heatmaps in the manuscript were plotted using heatmap.2 function of gplots package available in R environment R package documentation https://rdrr.io/cran/gplots/ src/R/heatmap.2.R Fast Greedy Equivalence Search algorithm Center for Causal Discovery rcausal (Tetrad https://www.ccd. pitt.edu/tools/) R package https://rdrr.io/github/bd2kccd/r-causal/ Mergeomics R package http://mergeomics. research.idre.ucla.edu/ https://rdrr.io/github/ zeynebkurtUCLA/Mergeomics/ (Continued on next page) 18 Cell Reports 42, 113371, November 28, 2023
Recombinant:Article Title: Integration of transcriptomes of senescent cell models with multi-tissue patient samples reveals reduced COL6A3 as an inducer of senescence.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti rabbit Alexa Fluor 594 Life Technology Thermo Fisher Scientific Cat# A-11037; RRID:AB_2534095 p16 antibody clone E6H4 Roche Roche Cat# 705–4793; RRID:AB_2833232 Ki67 antibody Thermo RM 9106-50 Goat anti mouse Alexa Fluor 647 Thermo Thermo Fisher Scientific Cat# A32728; RRID:AB_2633277 ClickiT EdU Alexa Fluor 488 imaging kit Thermo C10337 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin Corning 30-002-Cl Hoechst 33342 Fisher H3570 FBS (validation experiments) Gibco 10438–026 EGM-2 Bulletkit Lonza CC-3162 REGM Bulletkit Lonza CC-3190 EGM-2 MV Bulletkit Lonza CC-3202 ADSC Bulletkit Lonza PT-4505 Power SYBRTM Green PCR Master Mix Applied Biosystems 4368706 Control shRNA lentiviral particles Santa Cruz sc-108080 COL6A3 shRNA lentiviral particles Santa Cruz sc-94560-V Doxycycline hyclate Sigma D9891 Insulin Thermo 12585014 Trizol Thermo 15596018 Puromycin ThermoFisher A1113803 DAPI containing mounting medium Vector Laboratories H-1500 Vestashield Mounting Medium for fluorescence Vector Laboratory Inc H-1000 DMEM medium VWR VWRL0101-0500 Bleomycin SelleckChem Catalog No.S1214 Oligomycin SelleckChem Catalog No.S1214 Rotenone Sigma Catalog No.A8674 Antimycin SelleckChem Catalog No.S2348 Critical commercial assays RNeasy Mini Kit Qiagen 74104 Super script IV Kit Invitrogen 180901050 Senescence Detection Kit K320 BioVision https://www.biovision.com/products/ aging/aging-assay-kits/ senescence-detection-kit.html TruSeq Stranded mRNA library prep kit Illumina https://www.illumina.com/products/ by-type/sequencing-kits/library-prep-kits/ truseq-stranded-mrna.html RNase-free DNase Set Qiagen 79254 Deposited data RNAseq data GEO GSE230181 and GSE230357 Experimental models: Cell lines Human Adipose-derived Stem Cells (ADSC) Lonza PT-5006 Human lung fibroblasts IMR-90 cells (IMR90) ATCC Cat# CCL-186; RRID:CVCL_0347 (Continued on next page) Cell Reports 42, 113371, November 28, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Microvascular Endothelial Cells (HMVEC) Lonza CC-2527 Human Umbilical Vein Endothelial Cells (HUVEC) Lonza C2519A Renal Proximal Tubule Epithelial Cells (RPTEC) Lonza CC-2553 Oligonucleotides COL6A3 Forward primers GAAGCAGAACCTCACGGTCA This paper N/A COL6A3 Reverse primers GTAGCAGACCACAGCCACAT This paper N/A RPLP0 Forward primers: GTGATGCCCAGGGAAGACAA This paper N/A RPLP0 Reverse primers: CCACATTGTCTGCTCCCACA This paper N/A Software and algorithms TopHat2 Kim et al.51 TopHat (RRID:SCR_013035); http://ccb.jhu.edu/software/tophat Cufflinks Trapnell et al.52 Cufflinks (RRID:SCR_014597); https://github.com/cole-trapnell-lab/cufflinks DESeq2 Love et al.53 DESeq2 (RRID:SCR_015687); http://www.bioconductor.org/ packages/release/bioc/html/DESeq2.html HTSeq Anders et al.54 https://pypi.python.org/pypi/HTSeq SDS 2.2.1 software Applied Biosystems N/A STAR RNA-seq aligner v2.7.3a GitHub https://github.com/alexdobin/ STAR/releases?page=3 UpSet plot https://upset.app/ UpSet (RRID:SCR_022731); https://www.rdocumentation.org/ packages/UpSetR/versions/1.4.0 Reactome Reactome Reactome (RRID:SCR_003485); https://reactome.org/ ClueGO (v2.5.6) Cytoscape App Store,55 https://apps.cytoscape.org/apps/cluego Cytoscape (v3.7.2) Cytoscape, Shannon et al.56 Cytoscape (RRID:SCR_003032); https://cytoscape.org/ Ingenuity Pathways Analysis Qiagen, Kramer et al.57 Ingenuity Pathway Analysis (RRID:SCR_008653); https://digitalinsights.qiagen.com/ product-login/ ImageJ NIH ImageJ (RRID:SCR_003070); https://imagej.nih.gov/ij/ GSEA v4.1.0 [build:27] GSEA-MSigDB; Subramanian et al., and Mootha et al.58,59 Gene Set Enrichment Analysis (RRID:SCR_003199); https://www.gsea-msigdb.org/ gsea/index.jsp SuperExactTest Wang et al.60 https://cran.r-project.org/web/ packages/SuperExactTest/index.html All heatmaps in the manuscript were plotted using heatmap.2 function of gplots package available in R environment R package documentation https://rdrr.io/cran/gplots/ src/R/heatmap.2.R Fast Greedy Equivalence Search algorithm Center for Causal Discovery rcausal (Tetrad https://www.ccd. pitt.edu/tools/) R package https://rdrr.io/github/bd2kccd/r-causal/ Mergeomics R package http://mergeomics. research.idre.ucla.edu/ https://rdrr.io/github/ zeynebkurtUCLA/Mergeomics/ (Continued on next page) 18 Cell Reports 42, 113371, November 28, 2023
Biomarker Discovery:Article Title: Integration of transcriptomes of senescent cell models with multi-tissue patient samples reveals reduced COL6A3 as an inducer of senescence.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti rabbit Alexa Fluor 594 Life Technology Thermo Fisher Scientific Cat# A-11037; RRID:AB_2534095 p16 antibody clone E6H4 Roche Roche Cat# 705–4793; RRID:AB_2833232 Ki67 antibody Thermo RM 9106-50 Goat anti mouse Alexa Fluor 647 Thermo Thermo Fisher Scientific Cat# A32728; RRID:AB_2633277 ClickiT EdU Alexa Fluor 488 imaging kit Thermo C10337 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin Corning 30-002-Cl Hoechst 33342 Fisher H3570 FBS (validation experiments) Gibco 10438–026 EGM-2 Bulletkit Lonza CC-3162 REGM Bulletkit Lonza CC-3190 EGM-2 MV Bulletkit Lonza CC-3202 ADSC Bulletkit Lonza PT-4505 Power SYBRTM Green PCR Master Mix Applied Biosystems 4368706 Control shRNA lentiviral particles Santa Cruz sc-108080 COL6A3 shRNA lentiviral particles Santa Cruz sc-94560-V Doxycycline hyclate Sigma D9891 Insulin Thermo 12585014 Trizol Thermo 15596018 Puromycin ThermoFisher A1113803 DAPI containing mounting medium Vector Laboratories H-1500 Vestashield Mounting Medium for fluorescence Vector Laboratory Inc H-1000 DMEM medium VWR VWRL0101-0500 Bleomycin SelleckChem Catalog No.S1214 Oligomycin SelleckChem Catalog No.S1214 Rotenone Sigma Catalog No.A8674 Antimycin SelleckChem Catalog No.S2348 Critical commercial assays RNeasy Mini Kit Qiagen 74104 Super script IV Kit Invitrogen 180901050 Senescence Detection Kit K320 BioVision https://www.biovision.com/products/ aging/aging-assay-kits/ senescence-detection-kit.html TruSeq Stranded mRNA library prep kit Illumina https://www.illumina.com/products/ by-type/sequencing-kits/library-prep-kits/ truseq-stranded-mrna.html RNase-free DNase Set Qiagen 79254 Deposited data RNAseq data GEO GSE230181 and GSE230357 Experimental models: Cell lines Human Adipose-derived Stem Cells (ADSC) Lonza PT-5006 Human lung fibroblasts IMR-90 cells (IMR90) ATCC Cat# CCL-186; RRID:CVCL_0347 (Continued on next page) Cell Reports 42, 113371, November 28, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Microvascular Endothelial Cells (HMVEC) Lonza CC-2527 Human Umbilical Vein Endothelial Cells (HUVEC) Lonza C2519A Renal Proximal Tubule Epithelial Cells (RPTEC) Lonza CC-2553 Oligonucleotides COL6A3 Forward primers GAAGCAGAACCTCACGGTCA This paper N/A COL6A3 Reverse primers GTAGCAGACCACAGCCACAT This paper N/A RPLP0 Forward primers: GTGATGCCCAGGGAAGACAA This paper N/A RPLP0 Reverse primers: CCACATTGTCTGCTCCCACA This paper N/A Software and algorithms TopHat2 Kim et al.51 TopHat (RRID:SCR_013035); http://ccb.jhu.edu/software/tophat Cufflinks Trapnell et al.52 Cufflinks (RRID:SCR_014597); https://github.com/cole-trapnell-lab/cufflinks DESeq2 Love et al.53 DESeq2 (RRID:SCR_015687); http://www.bioconductor.org/ packages/release/bioc/html/DESeq2.html HTSeq Anders et al.54 https://pypi.python.org/pypi/HTSeq SDS 2.2.1 software Applied Biosystems N/A STAR RNA-seq aligner v2.7.3a GitHub https://github.com/alexdobin/ STAR/releases?page=3 UpSet plot https://upset.app/ UpSet (RRID:SCR_022731); https://www.rdocumentation.org/ packages/UpSetR/versions/1.4.0 Reactome Reactome Reactome (RRID:SCR_003485); https://reactome.org/ ClueGO (v2.5.6) Cytoscape App Store,55 https://apps.cytoscape.org/apps/cluego Cytoscape (v3.7.2) Cytoscape, Shannon et al.56 Cytoscape (RRID:SCR_003032); https://cytoscape.org/ Ingenuity Pathways Analysis Qiagen, Kramer et al.57 Ingenuity Pathway Analysis (RRID:SCR_008653); https://digitalinsights.qiagen.com/ product-login/ ImageJ NIH ImageJ (RRID:SCR_003070); https://imagej.nih.gov/ij/ GSEA v4.1.0 [build:27] GSEA-MSigDB; Subramanian et al., and Mootha et al.58,59 Gene Set Enrichment Analysis (RRID:SCR_003199); https://www.gsea-msigdb.org/ gsea/index.jsp SuperExactTest Wang et al.60 https://cran.r-project.org/web/ packages/SuperExactTest/index.html All heatmaps in the manuscript were plotted using heatmap.2 function of gplots package available in R environment R package documentation https://rdrr.io/cran/gplots/ src/R/heatmap.2.R Fast Greedy Equivalence Search algorithm Center for Causal Discovery rcausal (Tetrad https://www.ccd. pitt.edu/tools/) R package https://rdrr.io/github/bd2kccd/r-causal/ Mergeomics R package http://mergeomics. research.idre.ucla.edu/ https://rdrr.io/github/ zeynebkurtUCLA/Mergeomics/ (Continued on next page) 18 Cell Reports 42, 113371, November 28, 2023
Polymerase Chain Reaction:Article Title: Integration of transcriptomes of senescent cell models with multi-tissue patient samples reveals reduced COL6A3 as an inducer of senescence.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti rabbit Alexa Fluor 594 Life Technology Thermo Fisher Scientific Cat# A-11037; RRID:AB_2534095 p16 antibody clone E6H4 Roche Roche Cat# 705–4793; RRID:AB_2833232 Ki67 antibody Thermo RM 9106-50 Goat anti mouse Alexa Fluor 647 Thermo Thermo Fisher Scientific Cat# A32728; RRID:AB_2633277 ClickiT EdU Alexa Fluor 488 imaging kit Thermo C10337 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin Corning 30-002-Cl Hoechst 33342 Fisher H3570 FBS (validation experiments) Gibco 10438–026 EGM-2 Bulletkit Lonza CC-3162 REGM Bulletkit Lonza CC-3190 EGM-2 MV Bulletkit Lonza CC-3202 ADSC Bulletkit Lonza PT-4505 Power SYBRTM Green PCR Master Mix Applied Biosystems 4368706 Control shRNA lentiviral particles Santa Cruz sc-108080 COL6A3 shRNA lentiviral particles Santa Cruz sc-94560-V Doxycycline hyclate Sigma D9891 Insulin Thermo 12585014 Trizol Thermo 15596018 Puromycin ThermoFisher A1113803 DAPI containing mounting medium Vector Laboratories H-1500 Vestashield Mounting Medium for fluorescence Vector Laboratory Inc H-1000 DMEM medium VWR VWRL0101-0500 Bleomycin SelleckChem Catalog No.S1214 Oligomycin SelleckChem Catalog No.S1214 Rotenone Sigma Catalog No.A8674 Antimycin SelleckChem Catalog No.S2348 Critical commercial assays RNeasy Mini Kit Qiagen 74104 Super script IV Kit Invitrogen 180901050 Senescence Detection Kit K320 BioVision https://www.biovision.com/products/ aging/aging-assay-kits/ senescence-detection-kit.html TruSeq Stranded mRNA library prep kit Illumina https://www.illumina.com/products/ by-type/sequencing-kits/library-prep-kits/ truseq-stranded-mrna.html RNase-free DNase Set Qiagen 79254 Deposited data RNAseq data GEO GSE230181 and GSE230357 Experimental models: Cell lines Human Adipose-derived Stem Cells (ADSC) Lonza PT-5006 Human lung fibroblasts IMR-90 cells (IMR90) ATCC Cat# CCL-186; RRID:CVCL_0347 (Continued on next page) Cell Reports 42, 113371, November 28, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Microvascular Endothelial Cells (HMVEC) Lonza CC-2527 Human Umbilical Vein Endothelial Cells (HUVEC) Lonza C2519A Renal Proximal Tubule Epithelial Cells (RPTEC) Lonza CC-2553 Oligonucleotides COL6A3 Forward primers GAAGCAGAACCTCACGGTCA This paper N/A COL6A3 Reverse primers GTAGCAGACCACAGCCACAT This paper N/A RPLP0 Forward primers: GTGATGCCCAGGGAAGACAA This paper N/A RPLP0 Reverse primers: CCACATTGTCTGCTCCCACA This paper N/A Software and algorithms TopHat2 Kim et al.51 TopHat (RRID:SCR_013035); http://ccb.jhu.edu/software/tophat Cufflinks Trapnell et al.52 Cufflinks (RRID:SCR_014597); https://github.com/cole-trapnell-lab/cufflinks DESeq2 Love et al.53 DESeq2 (RRID:SCR_015687); http://www.bioconductor.org/ packages/release/bioc/html/DESeq2.html HTSeq Anders et al.54 https://pypi.python.org/pypi/HTSeq SDS 2.2.1 software Applied Biosystems N/A STAR RNA-seq aligner v2.7.3a GitHub https://github.com/alexdobin/ STAR/releases?page=3 UpSet plot https://upset.app/ UpSet (RRID:SCR_022731); https://www.rdocumentation.org/ packages/UpSetR/versions/1.4.0 Reactome Reactome Reactome (RRID:SCR_003485); https://reactome.org/ ClueGO (v2.5.6) Cytoscape App Store,55 https://apps.cytoscape.org/apps/cluego Cytoscape (v3.7.2) Cytoscape, Shannon et al.56 Cytoscape (RRID:SCR_003032); https://cytoscape.org/ Ingenuity Pathways Analysis Qiagen, Kramer et al.57 Ingenuity Pathway Analysis (RRID:SCR_008653); https://digitalinsights.qiagen.com/ product-login/ ImageJ NIH ImageJ (RRID:SCR_003070); https://imagej.nih.gov/ij/ GSEA v4.1.0 [build:27] GSEA-MSigDB; Subramanian et al., and Mootha et al.58,59 Gene Set Enrichment Analysis (RRID:SCR_003199); https://www.gsea-msigdb.org/ gsea/index.jsp SuperExactTest Wang et al.60 https://cran.r-project.org/web/ packages/SuperExactTest/index.html All heatmaps in the manuscript were plotted using heatmap.2 function of gplots package available in R environment R package documentation https://rdrr.io/cran/gplots/ src/R/heatmap.2.R Fast Greedy Equivalence Search algorithm Center for Causal Discovery rcausal (Tetrad https://www.ccd. pitt.edu/tools/) R package https://rdrr.io/github/bd2kccd/r-causal/ Mergeomics R package http://mergeomics. research.idre.ucla.edu/ https://rdrr.io/github/ zeynebkurtUCLA/Mergeomics/ (Continued on next page) 18 Cell Reports 42, 113371, November 28, 2023
Control:Article Title: Integration of transcriptomes of senescent cell models with multi-tissue patient samples reveals reduced COL6A3 as an inducer of senescence.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti rabbit Alexa Fluor 594 Life Technology Thermo Fisher Scientific Cat# A-11037; RRID:AB_2534095 p16 antibody clone E6H4 Roche Roche Cat# 705–4793; RRID:AB_2833232 Ki67 antibody Thermo RM 9106-50 Goat anti mouse Alexa Fluor 647 Thermo Thermo Fisher Scientific Cat# A32728; RRID:AB_2633277 ClickiT EdU Alexa Fluor 488 imaging kit Thermo C10337 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin Corning 30-002-Cl Hoechst 33342 Fisher H3570 FBS (validation experiments) Gibco 10438–026 EGM-2 Bulletkit Lonza CC-3162 REGM Bulletkit Lonza CC-3190 EGM-2 MV Bulletkit Lonza CC-3202 ADSC Bulletkit Lonza PT-4505 Power SYBRTM Green PCR Master Mix Applied Biosystems 4368706 Control shRNA lentiviral particles Santa Cruz sc-108080 COL6A3 shRNA lentiviral particles Santa Cruz sc-94560-V Doxycycline hyclate Sigma D9891 Insulin Thermo 12585014 Trizol Thermo 15596018 Puromycin ThermoFisher A1113803 DAPI containing mounting medium Vector Laboratories H-1500 Vestashield Mounting Medium for fluorescence Vector Laboratory Inc H-1000 DMEM medium VWR VWRL0101-0500 Bleomycin SelleckChem Catalog No.S1214 Oligomycin SelleckChem Catalog No.S1214 Rotenone Sigma Catalog No.A8674 Antimycin SelleckChem Catalog No.S2348 Critical commercial assays RNeasy Mini Kit Qiagen 74104 Super script IV Kit Invitrogen 180901050 Senescence Detection Kit K320 BioVision https://www.biovision.com/products/ aging/aging-assay-kits/ senescence-detection-kit.html TruSeq Stranded mRNA library prep kit Illumina https://www.illumina.com/products/ by-type/sequencing-kits/library-prep-kits/ truseq-stranded-mrna.html RNase-free DNase Set Qiagen 79254 Deposited data RNAseq data GEO GSE230181 and GSE230357 Experimental models: Cell lines Human Adipose-derived Stem Cells (ADSC) Lonza PT-5006 Human lung fibroblasts IMR-90 cells (IMR90) ATCC Cat# CCL-186; RRID:CVCL_0347 (Continued on next page) Cell Reports 42, 113371, November 28, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Microvascular Endothelial Cells (HMVEC) Lonza CC-2527 Human Umbilical Vein Endothelial Cells (HUVEC) Lonza C2519A Renal Proximal Tubule Epithelial Cells (RPTEC) Lonza CC-2553 Oligonucleotides COL6A3 Forward primers GAAGCAGAACCTCACGGTCA This paper N/A COL6A3 Reverse primers GTAGCAGACCACAGCCACAT This paper N/A RPLP0 Forward primers: GTGATGCCCAGGGAAGACAA This paper N/A RPLP0 Reverse primers: CCACATTGTCTGCTCCCACA This paper N/A Software and algorithms TopHat2 Kim et al.51 TopHat (RRID:SCR_013035); http://ccb.jhu.edu/software/tophat Cufflinks Trapnell et al.52 Cufflinks (RRID:SCR_014597); https://github.com/cole-trapnell-lab/cufflinks DESeq2 Love et al.53 DESeq2 (RRID:SCR_015687); http://www.bioconductor.org/ packages/release/bioc/html/DESeq2.html HTSeq Anders et al.54 https://pypi.python.org/pypi/HTSeq SDS 2.2.1 software Applied Biosystems N/A STAR RNA-seq aligner v2.7.3a GitHub https://github.com/alexdobin/ STAR/releases?page=3 UpSet plot https://upset.app/ UpSet (RRID:SCR_022731); https://www.rdocumentation.org/ packages/UpSetR/versions/1.4.0 Reactome Reactome Reactome (RRID:SCR_003485); https://reactome.org/ ClueGO (v2.5.6) Cytoscape App Store,55 https://apps.cytoscape.org/apps/cluego Cytoscape (v3.7.2) Cytoscape, Shannon et al.56 Cytoscape (RRID:SCR_003032); https://cytoscape.org/ Ingenuity Pathways Analysis Qiagen, Kramer et al.57 Ingenuity Pathway Analysis (RRID:SCR_008653); https://digitalinsights.qiagen.com/ product-login/ ImageJ NIH ImageJ (RRID:SCR_003070); https://imagej.nih.gov/ij/ GSEA v4.1.0 [build:27] GSEA-MSigDB; Subramanian et al., and Mootha et al.58,59 Gene Set Enrichment Analysis (RRID:SCR_003199); https://www.gsea-msigdb.org/ gsea/index.jsp SuperExactTest Wang et al.60 https://cran.r-project.org/web/ packages/SuperExactTest/index.html All heatmaps in the manuscript were plotted using heatmap.2 function of gplots package available in R environment R package documentation https://rdrr.io/cran/gplots/ src/R/heatmap.2.R Fast Greedy Equivalence Search algorithm Center for Causal Discovery rcausal (Tetrad https://www.ccd. pitt.edu/tools/) R package https://rdrr.io/github/bd2kccd/r-causal/ Mergeomics R package http://mergeomics. research.idre.ucla.edu/ https://rdrr.io/github/ zeynebkurtUCLA/Mergeomics/ (Continued on next page) 18 Cell Reports 42, 113371, November 28, 2023
shRNA:Article Title: Integration of transcriptomes of senescent cell models with multi-tissue patient samples reveals reduced COL6A3 as an inducer of senescence.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti rabbit Alexa Fluor 594 Life Technology Thermo Fisher Scientific Cat# A-11037; RRID:AB_2534095 p16 antibody clone E6H4 Roche Roche Cat# 705–4793; RRID:AB_2833232 Ki67 antibody Thermo RM 9106-50 Goat anti mouse Alexa Fluor 647 Thermo Thermo Fisher Scientific Cat# A32728; RRID:AB_2633277 ClickiT EdU Alexa Fluor 488 imaging kit Thermo C10337 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin Corning 30-002-Cl Hoechst 33342 Fisher H3570 FBS (validation experiments) Gibco 10438–026 EGM-2 Bulletkit Lonza CC-3162 REGM Bulletkit Lonza CC-3190 EGM-2 MV Bulletkit Lonza CC-3202 ADSC Bulletkit Lonza PT-4505 Power SYBRTM Green PCR Master Mix Applied Biosystems 4368706 Control shRNA lentiviral particles Santa Cruz sc-108080 COL6A3 shRNA lentiviral particles Santa Cruz sc-94560-V Doxycycline hyclate Sigma D9891 Insulin Thermo 12585014 Trizol Thermo 15596018 Puromycin ThermoFisher A1113803 DAPI containing mounting medium Vector Laboratories H-1500 Vestashield Mounting Medium for fluorescence Vector Laboratory Inc H-1000 DMEM medium VWR VWRL0101-0500 Bleomycin SelleckChem Catalog No.S1214 Oligomycin SelleckChem Catalog No.S1214 Rotenone Sigma Catalog No.A8674 Antimycin SelleckChem Catalog No.S2348 Critical commercial assays RNeasy Mini Kit Qiagen 74104 Super script IV Kit Invitrogen 180901050 Senescence Detection Kit K320 BioVision https://www.biovision.com/products/ aging/aging-assay-kits/ senescence-detection-kit.html TruSeq Stranded mRNA library prep kit Illumina https://www.illumina.com/products/ by-type/sequencing-kits/library-prep-kits/ truseq-stranded-mrna.html RNase-free DNase Set Qiagen 79254 Deposited data RNAseq data GEO GSE230181 and GSE230357 Experimental models: Cell lines Human Adipose-derived Stem Cells (ADSC) Lonza PT-5006 Human lung fibroblasts IMR-90 cells (IMR90) ATCC Cat# CCL-186; RRID:CVCL_0347 (Continued on next page) Cell Reports 42, 113371, November 28, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Microvascular Endothelial Cells (HMVEC) Lonza CC-2527 Human Umbilical Vein Endothelial Cells (HUVEC) Lonza C2519A Renal Proximal Tubule Epithelial Cells (RPTEC) Lonza CC-2553 Oligonucleotides COL6A3 Forward primers GAAGCAGAACCTCACGGTCA This paper N/A COL6A3 Reverse primers GTAGCAGACCACAGCCACAT This paper N/A RPLP0 Forward primers: GTGATGCCCAGGGAAGACAA This paper N/A RPLP0 Reverse primers: CCACATTGTCTGCTCCCACA This paper N/A Software and algorithms TopHat2 Kim et al.51 TopHat (RRID:SCR_013035); http://ccb.jhu.edu/software/tophat Cufflinks Trapnell et al.52 Cufflinks (RRID:SCR_014597); https://github.com/cole-trapnell-lab/cufflinks DESeq2 Love et al.53 DESeq2 (RRID:SCR_015687); http://www.bioconductor.org/ packages/release/bioc/html/DESeq2.html HTSeq Anders et al.54 https://pypi.python.org/pypi/HTSeq SDS 2.2.1 software Applied Biosystems N/A STAR RNA-seq aligner v2.7.3a GitHub https://github.com/alexdobin/ STAR/releases?page=3 UpSet plot https://upset.app/ UpSet (RRID:SCR_022731); https://www.rdocumentation.org/ packages/UpSetR/versions/1.4.0 Reactome Reactome Reactome (RRID:SCR_003485); https://reactome.org/ ClueGO (v2.5.6) Cytoscape App Store,55 https://apps.cytoscape.org/apps/cluego Cytoscape (v3.7.2) Cytoscape, Shannon et al.56 Cytoscape (RRID:SCR_003032); https://cytoscape.org/ Ingenuity Pathways Analysis Qiagen, Kramer et al.57 Ingenuity Pathway Analysis (RRID:SCR_008653); https://digitalinsights.qiagen.com/ product-login/ ImageJ NIH ImageJ (RRID:SCR_003070); https://imagej.nih.gov/ij/ GSEA v4.1.0 [build:27] GSEA-MSigDB; Subramanian et al., and Mootha et al.58,59 Gene Set Enrichment Analysis (RRID:SCR_003199); https://www.gsea-msigdb.org/ gsea/index.jsp SuperExactTest Wang et al.60 https://cran.r-project.org/web/ packages/SuperExactTest/index.html All heatmaps in the manuscript were plotted using heatmap.2 function of gplots package available in R environment R package documentation https://rdrr.io/cran/gplots/ src/R/heatmap.2.R Fast Greedy Equivalence Search algorithm Center for Causal Discovery rcausal (Tetrad https://www.ccd. pitt.edu/tools/) R package https://rdrr.io/github/bd2kccd/r-causal/ Mergeomics R package http://mergeomics. research.idre.ucla.edu/ https://rdrr.io/github/ zeynebkurtUCLA/Mergeomics/ (Continued on next page) 18 Cell Reports 42, 113371, November 28, 2023
Fluorescence:Article Title: Integration of transcriptomes of senescent cell models with multi-tissue patient samples reveals reduced COL6A3 as an inducer of senescence.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti rabbit Alexa Fluor 594 Life Technology Thermo Fisher Scientific Cat# A-11037; RRID:AB_2534095 p16 antibody clone E6H4 Roche Roche Cat# 705–4793; RRID:AB_2833232 Ki67 antibody Thermo RM 9106-50 Goat anti mouse Alexa Fluor 647 Thermo Thermo Fisher Scientific Cat# A32728; RRID:AB_2633277 ClickiT EdU Alexa Fluor 488 imaging kit Thermo C10337 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin Corning 30-002-Cl Hoechst 33342 Fisher H3570 FBS (validation experiments) Gibco 10438–026 EGM-2 Bulletkit Lonza CC-3162 REGM Bulletkit Lonza CC-3190 EGM-2 MV Bulletkit Lonza CC-3202 ADSC Bulletkit Lonza PT-4505 Power SYBRTM Green PCR Master Mix Applied Biosystems 4368706 Control shRNA lentiviral particles Santa Cruz sc-108080 COL6A3 shRNA lentiviral particles Santa Cruz sc-94560-V Doxycycline hyclate Sigma D9891 Insulin Thermo 12585014 Trizol Thermo 15596018 Puromycin ThermoFisher A1113803 DAPI containing mounting medium Vector Laboratories H-1500 Vestashield Mounting Medium for fluorescence Vector Laboratory Inc H-1000 DMEM medium VWR VWRL0101-0500 Bleomycin SelleckChem Catalog No.S1214 Oligomycin SelleckChem Catalog No.S1214 Rotenone Sigma Catalog No.A8674 Antimycin SelleckChem Catalog No.S2348 Critical commercial assays RNeasy Mini Kit Qiagen 74104 Super script IV Kit Invitrogen 180901050 Senescence Detection Kit K320 BioVision https://www.biovision.com/products/ aging/aging-assay-kits/ senescence-detection-kit.html TruSeq Stranded mRNA library prep kit Illumina https://www.illumina.com/products/ by-type/sequencing-kits/library-prep-kits/ truseq-stranded-mrna.html RNase-free DNase Set Qiagen 79254 Deposited data RNAseq data GEO GSE230181 and GSE230357 Experimental models: Cell lines Human Adipose-derived Stem Cells (ADSC) Lonza PT-5006 Human lung fibroblasts IMR-90 cells (IMR90) ATCC Cat# CCL-186; RRID:CVCL_0347 (Continued on next page) Cell Reports 42, 113371, November 28, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Microvascular Endothelial Cells (HMVEC) Lonza CC-2527 Human Umbilical Vein Endothelial Cells (HUVEC) Lonza C2519A Renal Proximal Tubule Epithelial Cells (RPTEC) Lonza CC-2553 Oligonucleotides COL6A3 Forward primers GAAGCAGAACCTCACGGTCA This paper N/A COL6A3 Reverse primers GTAGCAGACCACAGCCACAT This paper N/A RPLP0 Forward primers: GTGATGCCCAGGGAAGACAA This paper N/A RPLP0 Reverse primers: CCACATTGTCTGCTCCCACA This paper N/A Software and algorithms TopHat2 Kim et al.51 TopHat (RRID:SCR_013035); http://ccb.jhu.edu/software/tophat Cufflinks Trapnell et al.52 Cufflinks (RRID:SCR_014597); https://github.com/cole-trapnell-lab/cufflinks DESeq2 Love et al.53 DESeq2 (RRID:SCR_015687); http://www.bioconductor.org/ packages/release/bioc/html/DESeq2.html HTSeq Anders et al.54 https://pypi.python.org/pypi/HTSeq SDS 2.2.1 software Applied Biosystems N/A STAR RNA-seq aligner v2.7.3a GitHub https://github.com/alexdobin/ STAR/releases?page=3 UpSet plot https://upset.app/ UpSet (RRID:SCR_022731); https://www.rdocumentation.org/ packages/UpSetR/versions/1.4.0 Reactome Reactome Reactome (RRID:SCR_003485); https://reactome.org/ ClueGO (v2.5.6) Cytoscape App Store,55 https://apps.cytoscape.org/apps/cluego Cytoscape (v3.7.2) Cytoscape, Shannon et al.56 Cytoscape (RRID:SCR_003032); https://cytoscape.org/ Ingenuity Pathways Analysis Qiagen, Kramer et al.57 Ingenuity Pathway Analysis (RRID:SCR_008653); https://digitalinsights.qiagen.com/ product-login/ ImageJ NIH ImageJ (RRID:SCR_003070); https://imagej.nih.gov/ij/ GSEA v4.1.0 [build:27] GSEA-MSigDB; Subramanian et al., and Mootha et al.58,59 Gene Set Enrichment Analysis (RRID:SCR_003199); https://www.gsea-msigdb.org/ gsea/index.jsp SuperExactTest Wang et al.60 https://cran.r-project.org/web/ packages/SuperExactTest/index.html All heatmaps in the manuscript were plotted using heatmap.2 function of gplots package available in R environment R package documentation https://rdrr.io/cran/gplots/ src/R/heatmap.2.R Fast Greedy Equivalence Search algorithm Center for Causal Discovery rcausal (Tetrad https://www.ccd. pitt.edu/tools/) R package https://rdrr.io/github/bd2kccd/r-causal/ Mergeomics R package http://mergeomics. research.idre.ucla.edu/ https://rdrr.io/github/ zeynebkurtUCLA/Mergeomics/ (Continued on next page) 18 Cell Reports 42, 113371, November 28, 2023
RNA sequencing:Article Title: Integration of transcriptomes of senescent cell models with multi-tissue patient samples reveals reduced COL6A3 as an inducer of senescence.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti rabbit Alexa Fluor 594 Life Technology Thermo Fisher Scientific Cat# A-11037; RRID:AB_2534095 p16 antibody clone E6H4 Roche Roche Cat# 705–4793; RRID:AB_2833232 Ki67 antibody Thermo RM 9106-50 Goat anti mouse Alexa Fluor 647 Thermo Thermo Fisher Scientific Cat# A32728; RRID:AB_2633277 ClickiT EdU Alexa Fluor 488 imaging kit Thermo C10337 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin Corning 30-002-Cl Hoechst 33342 Fisher H3570 FBS (validation experiments) Gibco 10438–026 EGM-2 Bulletkit Lonza CC-3162 REGM Bulletkit Lonza CC-3190 EGM-2 MV Bulletkit Lonza CC-3202 ADSC Bulletkit Lonza PT-4505 Power SYBRTM Green PCR Master Mix Applied Biosystems 4368706 Control shRNA lentiviral particles Santa Cruz sc-108080 COL6A3 shRNA lentiviral particles Santa Cruz sc-94560-V Doxycycline hyclate Sigma D9891 Insulin Thermo 12585014 Trizol Thermo 15596018 Puromycin ThermoFisher A1113803 DAPI containing mounting medium Vector Laboratories H-1500 Vestashield Mounting Medium for fluorescence Vector Laboratory Inc H-1000 DMEM medium VWR VWRL0101-0500 Bleomycin SelleckChem Catalog No.S1214 Oligomycin SelleckChem Catalog No.S1214 Rotenone Sigma Catalog No.A8674 Antimycin SelleckChem Catalog No.S2348 Critical commercial assays RNeasy Mini Kit Qiagen 74104 Super script IV Kit Invitrogen 180901050 Senescence Detection Kit K320 BioVision https://www.biovision.com/products/ aging/aging-assay-kits/ senescence-detection-kit.html TruSeq Stranded mRNA library prep kit Illumina https://www.illumina.com/products/ by-type/sequencing-kits/library-prep-kits/ truseq-stranded-mrna.html RNase-free DNase Set Qiagen 79254 Deposited data RNAseq data GEO GSE230181 and GSE230357 Experimental models: Cell lines Human Adipose-derived Stem Cells (ADSC) Lonza PT-5006 Human lung fibroblasts IMR-90 cells (IMR90) ATCC Cat# CCL-186; RRID:CVCL_0347 (Continued on next page) Cell Reports 42, 113371, November 28, 2023 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human Microvascular Endothelial Cells (HMVEC) Lonza CC-2527 Human Umbilical Vein Endothelial Cells (HUVEC) Lonza C2519A Renal Proximal Tubule Epithelial Cells (RPTEC) Lonza CC-2553 Oligonucleotides COL6A3 Forward primers GAAGCAGAACCTCACGGTCA This paper N/A COL6A3 Reverse primers GTAGCAGACCACAGCCACAT This paper N/A RPLP0 Forward primers: GTGATGCCCAGGGAAGACAA This paper N/A RPLP0 Reverse primers: CCACATTGTCTGCTCCCACA This paper N/A Software and algorithms TopHat2 Kim et al.51 TopHat (RRID:SCR_013035); http://ccb.jhu.edu/software/tophat Cufflinks Trapnell et al.52 Cufflinks (RRID:SCR_014597); https://github.com/cole-trapnell-lab/cufflinks DESeq2 Love et al.53 DESeq2 (RRID:SCR_015687); http://www.bioconductor.org/ packages/release/bioc/html/DESeq2.html HTSeq Anders et al.54 https://pypi.python.org/pypi/HTSeq SDS 2.2.1 software Applied Biosystems N/A STAR RNA-seq aligner v2.7.3a GitHub https://github.com/alexdobin/ STAR/releases?page=3 UpSet plot https://upset.app/ UpSet (RRID:SCR_022731); https://www.rdocumentation.org/ packages/UpSetR/versions/1.4.0 Reactome Reactome Reactome (RRID:SCR_003485); https://reactome.org/ ClueGO (v2.5.6) Cytoscape App Store,55 https://apps.cytoscape.org/apps/cluego Cytoscape (v3.7.2) Cytoscape, Shannon et al.56 Cytoscape (RRID:SCR_003032); https://cytoscape.org/ Ingenuity Pathways Analysis Qiagen, Kramer et al.57 Ingenuity Pathway Analysis (RRID:SCR_008653); https://digitalinsights.qiagen.com/ product-login/ ImageJ NIH ImageJ (RRID:SCR_003070); https://imagej.nih.gov/ij/ GSEA v4.1.0 [build:27] GSEA-MSigDB; Subramanian et al., and Mootha et al.58,59 Gene Set Enrichment Analysis (RRID:SCR_003199); https://www.gsea-msigdb.org/ gsea/index.jsp SuperExactTest Wang et al.60 https://cran.r-project.org/web/ packages/SuperExactTest/index.html All heatmaps in the manuscript were plotted using heatmap.2 function of gplots package available in R environment R package documentation https://rdrr.io/cran/gplots/ src/R/heatmap.2.R Fast Greedy Equivalence Search algorithm Center for Causal Discovery rcausal (Tetrad https://www.ccd. pitt.edu/tools/) R package https://rdrr.io/github/bd2kccd/r-causal/ Mergeomics R package http://mergeomics. research.idre.ucla.edu/ https://rdrr.io/github/ zeynebkurtUCLA/Mergeomics/ (Continued on next page) 18 Cell Reports 42, 113371, November 28, 2023
|
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 